Got a calling from God the Father... "SERVE GOD AND THOSE HE LOVES." I hope to always heed that. Happily married to a Marine Veteran.

(...)"Whom ever is navigating these storms and waters with us, we are aboard, and on deck, because alas~ WWG1WGA" ~R

In response SJ. Rocks to her Publication
In response memes matter to her Publication

EGFP Sequence (717bp without STOP CODON):
5'-
ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAA GTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGC TGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAG CAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTA CAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGG ACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAAC GGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACAC CCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACG AGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAG +STOP CODON-3'

(...)"Whom ever is navigating these storms and waters with us, we are aboard, and on deck, because alas~ WWG1WGA" ~R

In response The Mac to his Publication

What is the GFP nucleotide sequence?

Green fluorescent protein.

In response memes matter to her Publication

👍🏻

In response The Mac to his Publication
In response The Mac to his Publication

Inhibitors of cathepsin L prevent severe acute respiratory syndrome coronavirus entry
Graham Simmons*†, Dhaval N. Gosalia‡, Andrew J. Rennekamp*, Jacqueline D. Reeves*, Scott L. Diamond‡§, and Paul Bates*†
*Department of Microbiology, School of Medicine and Departments of ‡Bioengineering and §Chemical and Biomolecular Engineering, Institute for Medicine and Engineering, University of Pennsylvania, Philadelphia, PA 19104
Communicated by Harold E. Varmus, Memorial Sloan–Kettering Cancer Center, New York, NY, July 1, 2005 (received for review May 5, 2005)

In response The Mac to his Publication
In response The Mac to his Publication

Trypsin (EC 3.4.21.4) is a serine protease from the PA clan superfamily, found in the digestive system of many vertebrates, where it hydrolyzes proteins.[2][3] Trypsin is formed in the small intestine when its proenzyme form, the trypsinogen produced by the pancreas, is activated. Trypsin cuts peptide chains mainly at the carboxyl side of the amino acids lysine or arginine. It is used for numerous biotechnological processes. The process is commonly referred to as trypsin proteolysis or trypsinization, and proteins that have been digested/treated with trypsin are said to have been trypsinized.[4] Trypsin was discovered in 1876 by Wilhelm Kühne and was named from the Ancient Greek word for rubbing since it was first isolated by rubbing the pancreas with glycerin

In response The Mac to his Publication

Only people mentioned by @TheMac in this post can reply

In response The Mac to his Publication

Cathepsin L
Cathepsin L released from the lysosome into the newly formed autophagolysosomes degrades any trypsinogen which may be present and prevents its activation to trypsin, hence short-circuiting any inappropriate activation of other zymogen pro-enzymes.
From: Haschek and Rousseaux's Handbook of Toxicologic Pathology (Third Edition), 2013

In response The Mac to his Publication

CatL is probably involved in processing SARS-CoV-2 spike protein. As its inhibition is detrimental to SARS-CoV-2 infection and possibly exit from cells during late stages of infection, CatL could have been considered a valuable therapeutic target. Therefore, we describe here some drugs already in the market with potential CatL inhibiting capacity that could be used to treat COVID-19 patients.

(1) Show this thread