Got a calling from God the Father... "SERVE GOD AND THOSE HE LOVES." I hope to always heed that. Happily married to a Marine Veteran.

(...)"Whom ever is navigating these storms and waters with us, we are aboard, and on deck, because alas~ WWG1WGA" ~R

In response SJ. Rocks to her Publication
In response memes matter to her Publication

EGFP Sequence (717bp without STOP CODON):
5'-
ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAA GTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGC TGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAG CAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTA CAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGG ACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAAC GGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACAC CCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACG AGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAG +STOP CODON-3'

(...)"Whom ever is navigating these storms and waters with us, we are aboard, and on deck, because alas~ WWG1WGA" ~R

In response The Mac to his Publication

What is the GFP nucleotide sequence?

Green fluorescent protein.

In response memes matter to her Publication

👍🏻

In response The Mac to his Publication

Inhibitors of cathepsin L prevent severe acute respiratory syndrome coronavirus entry
Graham Simmons*†, Dhaval N. Gosalia‡, Andrew J. Rennekamp*, Jacqueline D. Reeves*, Scott L. Diamond‡§, and Paul Bates*†
*Department of Microbiology, School of Medicine and Departments of ‡Bioengineering and §Chemical and Biomolecular Engineering, Institute for Medicine and Engineering, University of Pennsylvania, Philadelphia, PA 19104
Communicated by Harold E. Varmus, Memorial Sloan–Kettering Cancer Center, New York, NY, July 1, 2005 (received for review May 5, 2005)

In response The Mac to his Publication

Only people mentioned by @TheMac in this post can reply

In response The Mac to his Publication
In response The Mac to his Publication
(1) Show this thread